U55  also known as U39
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD55 small nucleolar RNA, C/D box 55
	snoid : SR0000013
	Length : 74
	Abstract : Homo sapiens C/D box snoRNA U55. This snoRNA was cloned from HeLa cells by Kiss-Laszlo et al. (1996). It was independently discovered by a bioinformatics approach, and named U39, by Nicoloso et al. (1996). It is predicited to guide the 2'O-ribose methylation of 28S rRNA C2791. U55 shares the same host gene with the C/D box snoRNAs U38A, U38B and U40/U46 (RPS8).
	GenBank accession number : X96654
	Host gene : RPS8 (Ribosomal protein S8)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA C2791
	References : - Kiss-Laszlo, Z., Henry, Y., Bachellerie, J. P., Caizergues-Ferrer, M., and Kiss, T. (1996). Site-specific ribose methylation of preribosomal RNA: a novel function for small nucleolar RNAs. Cell, 85, 1077-1088. - Nicoloso, M., Qu, L. H., Michot, B., and Bachellerie, J. P. (1996). Intron-encoded, antisense small nucleolar RNAs: the characterization of nine novel species points to their direct role as guides for the 2'-O-ribose methylation of rRNAs. J Mol Biol, 260, 178-195.
	Sequence : >U55 GTGTATGATGACAACTCGGTAATGCTGCATACTCCCGAGTGCGCGGTGGGGAAGCCAACCTTGGAGAGCTGAGC
snoRNABase - http://www-snorna.biotoul.fr/