U57
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD57 small nucleolar RNA, C/D box 57
	snoid : SR0000289
	Length : 72
	Abstract : Homo sapiens C/D box snoRNA U57. This snoRNA was cloned from HeLa cells by Kiss-Laszlo et al. (1996). It is predicted to guide the 2'O-ribose methylation of 18S rRNA A99. The C/D box snoRNAs U57, U56, U86 and HBII-55, and the H/ACA box snoRNA ACA51 share the same host gene (NOL5A). This gene encodes the Nucleolar Protein 5A (also known as NOP56), one of the four core proteins of C/D box snRNPs.
	GenBank accession number : X96656
	Host gene : NOL5A (nucleolar protein 5A, or NOP56, a common constituent of C/D box snoRNPs)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA A99
	References : - Kiss-Laszlo, Z., Henry, Y., Bachellerie, J. P., Caizergues-Ferrer, M., and Kiss, T. (1996). Site-specific ribose methylation of preribosomal RNA: a novel function for small nucleolar RNAs. Cell, 85, 1077-1088.
	Sequence : >U57 TGGAGGTGATGAACTGTCTGAGCCTGACCTTGTAGAATGGAGGCAAAAAAACTGATTTAATGAGCCTGATCC
snoRNABase - http://www-snorna.biotoul.fr/