U62A
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD62A small nucleolar RNA, C/D box 62A
	snoid : SR0000359
	Length : 86
	Abstract : Homo sapiens C/D box snoRNA U62A. This snoRNA was cloned from RNAs immunoprecipitated with an anti-fibrillarin antibody (Tycowski et al. 1996). It is predicted to guide the 2'O-ribose methylation of 18S rRNA A590. U62A and a second exact copy, U62B, reside in the same host gene (KIAA0515 hypothetical protein).
	GenBank accession number : U72851
	Host gene : AB011087 (Hypothetical protein KIAA0515, 670aa)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA A590
	sno/scaRNAs with same target 18S rRNA A590 : U62B
	References : - Tycowski, K. T., Smith, C. M., Shu, M. D., and Steitz, J. A. (1996). A small nucleolar RNA requirement for site-specific ribose methylation of rRNA in Xenopus. Proc Natl Acad Sci U S A, 93, 14480-14485.
	Sequence : >U62A TCTCAGTGATGTAATTCCAATAGATCCTTCTGACCCTCCACTGTGGACTCAATAGCAGGGAGATGAAGAGGACAGTGACTGAGAGA
snoRNABase - http://www-snorna.biotoul.fr/