U67
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA67 small nucleolar RNA, H/ACA box 67
	snoid : SR0000230
	Length : 137
	Abstract : Homo sapiens U67 snoRNA. This H/ACA box RNA was cloned from HeLa cells by Ganot et al. (1997b). Its role in guiding pseudouridylation of U1445 in 18S rRNA was evidenced by Ganot et al. (1997a). The pseudouridylation of U1445 was experimentally confirmed by primer extension mapping by the same authors. U67, ACA48 and the C/D box snoRNA mgU6-77 share the same host gene (EIF4A1).
	GenBank accession number : Y11161
	Host gene : EIF4A1 (eukaryotic translation initiation factor 4A1)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U1445
	References : - Ganot, P., Bortolin, M. L., and Kiss, T. (1997a). Site-specific pseudouridine formation in preribosomal RNA is guided by small nucleolar RNAs. Cell 89, 799-809. - Ganot, P., Caizergues-Ferrer, M., and Kiss, T. (1997b). The family of box ACA small nucleolar RNAs is defined by an evolutionarily conserved secondary structure and ubiquitous sequence elements essential for RNA accumulation. Genes Dev 11, 941-956.
	Sequence : >U67 ATCCAAGGTGATTCCCTCTCCAAGGGGACATCAGTGCCTCTCAGGAAAGTAGCAGCTTGGAATAGAATCTGGCATGCCTAAGGCCTTTGGGGAACTGGGATGCTTATTTCCTCTGCCTTCCTTGGCTGCCCACATGG
snoRNABase - http://www-snorna.biotoul.fr/