U69
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA69 small nucleolar RNA, H/ACA box 69
	snoid : SR0000371
	Length : 132
	Abstract : Homo sapiens U69 snoRNA. This H/ACA box RNA was cloned from HeLa cells by Ganot et al. (1997b). Its role in guiding pseudouridylation of U36 in 18S rRNA and U69 in 5.8S rRNA was evidenced by Ganot et al. (1997a). The pseudouridylation of 18S U36 residue was previously reported Maden and Wakeman (1988).
	GenBank accession number : Y11163
	Host gene : RPL39 (ribosomal protein L39)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U36 and 5.8S rRNA U69
	References : - Ganot, P., Bortolin, M. L., and Kiss, T. (1997a). Site-specific pseudouridine formation in preribosomal RNA is guided by small nucleolar RNAs. Cell 89, 799-809. - Maden, E. H., and Wakeman, J. A. (1988). Pseudouridine distribution in mammalian 18 S ribosomal RNA. A major cluster in the central region of the molecule. Biochem J 249, 459-464. - Ganot, P., Caizergues-Ferrer, M., and Kiss, T. (1997b). The family of box ACA small nucleolar RNAs is defined by an evolutionarily conserved secondary structure and ubiquitous sequence elements essential for RNA accumulation. Genes Dev 11, 941-956.
	Sequence : >U69 AAAGCAGGTTGCAATTACAGTGCTTCATTTTGTGGAAGTACTGCCATTATCCTGCTGAAAGAAAAGCCGTGTTAATCATTTTTGATTTTGCCTTTATGAGGGTAAAATCATGACAGATTGACATGGACAATT
snoRNABase - http://www-snorna.biotoul.fr/