U71a
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA71A small nucleolar RNA, H/ACA box 71A
	snoid : SR0000292
	Length : 139
	Abstract : Homo sapiens U71a snoRNA. This H/ACA box RNA was cloned from HeLa cells by Ganot et al. (1997b). Like it close paralogue U71b, it is predicted to guide the pseudouridylation of U406 in 18S rRNA (Ganot et al. (1997a). The pseudouridylation of this residue was confirmed by the same authors. U71a and three related copies, U71b, U71c and U71d, share the same host gene.
	GenBank accession number : Y11165
	Host gene : spliced ESTs (no apparent protein)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U406
	sno/scaRNAs with same target 18S rRNA U406 : U71b   U71c   U71d
	References : - Ganot, P., Bortolin, M. L., and Kiss, T. (1997a). Site-specific pseudouridine formation in preribosomal RNA is guided by small nucleolar RNAs. Cell 89, 799-809. - Ganot, P., Caizergues-Ferrer, M., and Kiss, T. (1997b). The family of box ACA small nucleolar RNAs is defined by an evolutionarily conserved secondary structure and ubiquitous sequence elements essential for RNA accumulation. Genes Dev 11, 941-956.
	Sequence : >U71a CTCCTGCATCCGAAAGTGATCATAGGCTGCCTGTGCCTAGGTCATTGATAGTGCAGGGAGAGGAACGCTGAAAGAGGTTGTCCCCGTGTTTGGAGGGTCCACCCTATCCCATCCGAACCCTGAAGCTTTCACACAACT
snoRNABase - http://www-snorna.biotoul.fr/