U72
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA72 small nucleolar RNA, H/ACA box 72
	snoid : SR0000355
	Length : 132
	Abstract : Homo sapiens U72 snoRNA. This H/ACA box RNA was cloned from HeLa cells by Ganot et al. (1997b). It is predicted to guide pseudouridylation of U55 in 5.8S rRNA (Ganot et al., 1997a). The pseudouridylation of this residue was established by Ofengand and Bakin (1997). Note that the published sequence differs from the genomic sequence by 1nt.
	GenBank accession number : Y11167
	Host gene : RPL30 (ribosomal protein L30)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 5.8S rRNA U55
	References : - Ganot, P., Bortolin, M. L., and Kiss, T. (1997a). Site-specific pseudouridine formation in preribosomal RNA is guided by small nucleolar RNAs. Cell 89, 799-809. - Ofengand, J., and Bakin, A. (1997). Mapping to nucleotide resolution of pseudouridine residues in large subunit ribosomal RNAs from representative eukaryotes, prokaryotes, archaebacteria, mitochondria and chloroplasts. J Mol Biol 266, 246-268. - Ganot, P., Caizergues-Ferrer, M., and Kiss, T. (1997b). The family of box ACA small nucleolar RNAs is defined by an evolutionarily conserved secondary structure and ubiquitous sequence elements essential for RNA accumulation. Genes Dev 11, 941-956.
	Sequence : >U72 CTGCGAATATTCTCGCTGTTCTGATTTTGTAATAGTCAGGACAGGCTAAACATTCGCTATATTAAGACCATGCATGTGTCCCCAAACCTAGTTCTTTCCCTAGGTCTGGTTTTATAAATGCTGGTGATAAAC
snoRNABase - http://www-snorna.biotoul.fr/