U76
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD76 small nucleolar RNA, C/D box 76
	snoid : SR0000033
	Length : 80
	Abstract : Homo sapiens C/D box snoRNA U76. This snoRNA was localized in an intron of the human orthologue of the murine Growth arrest-specific transcript 5 (gas5) gene by Smith and Steitz (1998), and its expression verified by Northern blot. It is predicted to guide the 2'O-ribose methylation of 28S rRNA A2350. U76 and the C/D box snoRNAs U44, U47, U74, U75, U77, U78, U79, U80 and U81 share the same host gene (protein non-coding). The breakpoint of a t(1;3)(q25;q27) translocation that fuses the GAS5 gene to the BCL6 gene resides within the U76 sequence (Nakamura et al., 2008).
	GenBank accession number : AF141346
	Host gene : GAS5 (mRNA AL110141)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA A2350
	References : - Smith, C. M., and Steitz, J. A. (1998). Classification of gas5 as a multi-small-nucleolar-RNA (snoRNA) host gene and a member of the 5'-terminal oligopyrimidine gene family reveals common features of snoRNA host genes. Mol Cell Biol 18, 6897-6909. - Nakamura, Y., Takahashi, N., Kakegawa, E., Yoshida, K., Ito, Y., Kayano, H., Niitsu, N., Jinnai, I., and Bessho, M. (2008). The GAS5 (growth arrest-specific transcript 5) gene fuses to BCL6 as a result of t(1;3)(q25;q27) in a patient with B-cell lymphoma. Cancer Genet Cytogenet 182, 144-149.
	Sequence : >U76 GCCACAATGATGACAGTTTATTTGCTACTCTTGAGTGCTAGAATGATGAGGATCTTAACCACCATTATCTTAACTGAGGC
snoRNABase - http://www-snorna.biotoul.fr/