U84
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD84 small nucleolar RNA, C/D box 84
	snoid : SR0000333
	Length : 78
	Abstract : Homo sapiens C/D box snoRNA U84. This snoRNA was sequenced from a cDNA library of human snoRNAs by Jady and Kiss (2000). U84 has no identified RNA target, although it can guide the methylation of an artificial substrate. It resides in the nucleolar fraction, but, from sedimentation analysis, it is not associated with pre-ribosomal particules.
	GenBank accession number : AJ243199
	Host gene : BAT1 (ATP-dependent RNA helicase of the DEAD protein family)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : unknown
	References : - Jady, B. E., and Kiss, T. (2000). Characterisation of the U83 and U84 small nucleolar RNAs: two novel 2'-O-ribose methylation guide RNAs that lack complementarities to ribosomal RNAs. Nucleic Acids Res, 28, 1348-1354.
	Sequence : >U84 GCCATATGATGTTTTCTTTTCGAAAGGTGAGCGCTTTGCGCAGTGATGACCCTCATCTATCACCCTTGACTGATGGCT
snoRNABase - http://www-snorna.biotoul.fr/