U86
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD86 small nucleolar RNA, C/D box 86
	snoid : SR0000287
	Length : 86
	Abstract : Homo sapiens C/D box snoRNA U86. This snoRNA is the human orthologue of Xenopus laevis U86, that was initially characterized by the examination of intronic sequences of the Nop56 gene (Filippini et al., 2001). It has not identified RNA target. The C/D box snoRNAs U86, U56, U57 and HBII-55, and the H/ACA box snoRNA ACA51 share the same host gene.
	GenBank accession number : AJ311853
	Host gene : NOL5A (nucleolar protein 5A, or NOP56, a common constituent of C/D box snoRNPs)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : unknown
	References : - Filippini, D., Renzi, F., Bozzoni, I., and Caffarelli, E. (2001). U86, a novel snoRNA with an unprecedented gene organization in yeast. Biochem Biophys Res Commun, 288, 16-21.
	Sequence : >U86 GATCACGGTGATGGCTGACCAGGGCTCCCTGACCTATACAGGCCTCTGCTATGGGGGTGATGGCCAGTCCTGGTGTCTGAGTGATT
snoRNABase - http://www-snorna.biotoul.fr/