U92
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SCARNA8 small Cajal body-specific RNA 8
	snoid : SR0000356
	Length : 131
	Abstract : Homo sapiens U92 scaRNA This H/ACA box RNA was cloned by Darzacq et al. (2002) from HeLa cells. U92 co-localizes with coilin in Cajal bodies, and is predicted to guide pseudouridylation of U34 and U44 in U2 snRNA. The modification of these two residues was experimentally established by Shibata et al. (1975).
	GenBank accession number : AY077742
	Host gene : FAM29A (hypothetical protein,955aa)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : U2 snRNA U34 and U2 snRNA U44
	References : - Darzacq, X., Jady, B. E., Verheggen, C., Kiss, A. M., Bertrand, E., and Kiss, T. (2002). Cajal body-specific small nuclear RNAs: a novel class of 2'-O-methylation and pseudouridylation guide RNAs. Embo J 21, 2746-2756. - Shibata, H., Ro-Choi, T. S., Reddy, R., Choi, Y. C., Henning, D., and Busch, H. (1975). The primary nucleotide sequence of nuclear U-2 ribonucleic acid. The 5'-terminal portion of the molecule. J Biol Chem, 250, 3909-3920.
	Sequence : >U92 TGGGAGGCTGATACACAAATTGGGCTGAAATACTGCTCTACTTGTCACCATGCCTCCCTAGAATAAACTGCCTTTTGATGACCGGGACGAATTGAGTGAAATCGTAACGGACAGATACGGGGCAGACAGAT
snoRNABase - http://www-snorna.biotoul.fr/