U93
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SCARNA13 small Cajal body-specific RNA 13
	snoid : SR0000089
	Length : 275
	Abstract : Homo sapiens U93 scaRNA. This RNA was cloned by Kiss et al. (2002) from HeLa cells. It contains two tandemly arranged box H/ACA domains. FISH experiments showed that U93 co-localizes with coilin in Cajal bodies. U93 is predicted to guide the pseudouridylation of U54 of the U2 spliceosomal snRNA and U53 of snRNA U5 (Kiss et al., 2002; Schattner et al., 2006). The modification of these residues was experimentally established (Shibata et al., 1975; Reddy, 1988).
	GenBank accession number : AF492209
	Host gene : Cluster of ESTs (Unigene Hs.448753).
	Click here to see the position on the UCSC Genome Browser
	Target RNA : U2 snRNA U54 and U5 snRNA U53
	References : - Kiss, A. M., Jady, B. E., Darzacq, X., Verheggen, C., Bertrand, E., and Kiss, T. (2002). A Cajal body-specific pseudouridylation guide RNA is composed of two box H/ACA snoRNA-like domains. Nucleic Acids Res 30, 4643-4649. - Shibata, H., Ro-Choi, T. S., Reddy, R., Choi, Y. C., Henning, D., and Busch, H. (1975). The primary nucleotide sequence of nuclear U-2 ribonucleic acid. The 5'-terminal portion of the molecule. J Biol Chem, 250, 3909-3920. - Schattner, P., Barberan-Soler, S., and Lowe, T. M. (2006). A computational screen for mammalian pseudouridylation guide H/ACA RNAs. Rna 12, 15-25 - Reddy R (1988) Compilation of small RNA sequences. Nuc. Acids Res 16 Suppl: r71-85
	Sequence : >U93 AATCTGTAGTCTTGGAGCCGCACAGGGTTGGTGGTACCCTCGAGCACACCAGACTTGCAGAAAAAGCATACTCCAGAGGAAGCTGAGGCATGCCTGCTCGAGAGCCAGCTGTTCCATGTGCAATTTTCCTCTGATAGTTTCTGGTCACTGTTGCCACGGTGATAATGACTGGGCTATGTCATTATCTATCCGCCAACAGTAAGAGAAGCTTTGCAGTCGAGATATTGTTTAGCAGATGGAGTGTTTTCTGTTGAACACTAAGTACTGCCACAAGT
snoRNABase - http://www-snorna.biotoul.fr/