U95
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD95 small nucleolar RNA, C/D box 95
	snoid : SR0000330
	Length : 63
	Abstract : Homo sapiens C/D box snoRNA U95. This snoRNA was first cloned from a rat cDNA library, and its human orthologue identified by data base search (Vitali et al., 2003). It is predicted to guide the 2'O-ribose methylation of 28S rRNA A2802 and C2811. A single copy of human U95 resides in intron 1 of the GNB2L1 gene. In the mouse, two copies reside in introns 1 and 3 of the orthologous gene. In both species, intron 2 of the same gene hosts the snoRNA U96a.
	GenBank accession number : AY349594
	Host gene : GNB2L1 guanine nucleotide binding protein)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA A2802 and 28S rRNA C2811
	References : - Vitali, P., Royo, H., Seitz, H., Bachellerie, J. P., Huttenhofer, A., and Cavaille, J. (2003). Identification of 13 novel human modification guide RNAs. Nucleic Acids Res 31, 6543-6551.
	Sequence : >U95 GCGGTGATGACCCCAACATGCCATCTGAGTGTCGGTGCTGAAATCCAGAGGCTGTTTCTGAGC
snoRNABase - http://www-snorna.biotoul.fr/