U96a
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD96A small nucleolar RNA, C/D box 96A
	snoid : SR0000329
	Length : 72
	Abstract : Homo sapiens C/D box snoRNA U96a. This snoRNA was identified in a systematic search for conserved sequences in the introns of the GNB2L1 gene, the host gene of U95 (Vitali et al., 2003). In the human, but not the mouse, a second near perfect copy (U96b) resides in an intron of the AMMECR1 gene. Rodent U96 is also known as Z37 snoRNA. Both U96a and U96b are predicted to guide the 2'O-ribose methylation of 5.8S rRNA G75.
	GenBank accession number : AY349595
	Host gene : GNB2L1 (guanine nucleotide binding protein)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 5.8S rRNA G75
	sno/scaRNAs with same target 5.8S rRNA G75 : U96b
	References : - Vitali, P., Royo, H., Seitz, H., Bachellerie, J. P., Huttenhofer, A., and Cavaille, J. (2003). Identification of 13 novel human modification guide RNAs. Nucleic Acids Res 31, 6543-6551.
	Sequence : >U96a CCTGGTGATGACAGATGGCATTGTCAGCCAATCCCCAAGTGGGAGTGAGGACATGTCCTGCAATTCTGAAGG
snoRNABase - http://www-snorna.biotoul.fr/