U96b
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD96B small nucleolar RNA, C/D box 96B
	snoid : SR0000369
	Length : 72
	Abstract : Homo sapiens C/D box snoRNA U96b. This snoRNA was identified by Vitali et al. (2003) as a close paralogue of U96a (see this entry). It is encoded in an intron of the AMMECR1 gene. This gene is located on chrXq23 and is potentially involved in the pathogenesis of the Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis (OMIM%300195). However, the mouse orthologous gene does not contain sequences similar to that of U96. Both U96a and U96b are predicted to guide the 2'O-ribose methylation of 5.8S rRNA G75.
	GenBank accession number : AY349596
	Host gene : AMMECR1 (Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 5.8S rRNA G75
	sno/scaRNAs with same target 5.8S rRNA G75 : U96a
	References : - Vitali, P., Royo, H., Seitz, H., Bachellerie, J. P., Huttenhofer, A., and Cavaille, J. (2003). Identification of 13 novel human modification guide RNAs. Nucleic Acids Res 31, 6543-6551.
	Sequence : >U96b CCTGGTGATGACAGACGACATTGTCAGCCAATCCCCATGTGGTAGTGAGGACATGTCCTGCAGTTCTGAAGG
snoRNABase - http://www-snorna.biotoul.fr/