U97
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD97 small nucleolar RNA, C/D box 97
	snoid : SR0000049
	Length : 142
	Abstract : Homo sapiens C/D box snoRNA U97. This snoRNA was identified by Vitali et al. (2003) as the orthologue of the MBI-82 snoRNA. It has no predicted target RNA.
	GenBank accession number : AY349597
	Host gene : EIF4G2 (eukaryotic translation initiation factor 4 gamma 2)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : unknown
	References : - Vitali, P., Royo, H., Seitz, H., Bachellerie, J. P., Huttenhofer, A., and Cavaille, J. (2003). Identification of 13 novel human modification guide RNAs. Nucleic Acids Res 31, 6543-6551.
	Sequence : >U97 TTGCCCGATGATTATAAAAAGACGCGTTATTAAGAGGACTTTATGCTGGAGTTCTTGACGTTTTTCTCTCTTTTCTATACTTCTTTTTCTTTCTTTGAATGTCCAGCGTCCTGTGAGCGAAGATTATGAGATATGAGGGCAA
snoRNABase - http://www-snorna.biotoul.fr/