Home

Information

Search

Find guide Rna

Browse

Human-yeast snoRNAs

Links

Contact

Result of your query

ACA28
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA28 small nucleolar RNA, H/ACA box 28
	snoid : SR0000131
	Length : 127
	Abstract : Homo sapiens ACA28 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residues U815 and U866 of 18S rRNA. The pseudouridylation of these residues was previously reported by Maden and Wakeman (1988).
	GenBank accession number : AJ609462
	Host gene : EIF5 (eukaryotic translation initiation factor 5)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U815 and 18S rRNA U866
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Maden, E. H., and Wakeman, J. A. (1988). Pseudouridine distribution in mammalian 18 S ribosomal RNA. A major cluster in the central region of the molecule. Biochem J 249, 459-464.
	Sequence : >ACA28 AAGCAACACTCTGTGGCAGATGATCAAAACTGTCTGACACAATTTGAGCTTGCTATAGCAAGAAAGTCTAACCTATTCCGGTGTTCTCTCTCCCATGAGACAAGCCGTTATATAGACTTAAACAGT
	Phylogenic conservation: Alignment - Fasta file
Printer-friendly version