Home

Information

Search

Find guide Rna

Browse

Human-yeast snoRNAs

Links

Contact

Result of your query

ACA48
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA48 small nucleolar RNA, H/ACA box 48
	snoid : SR0000228
	Length : 135
	Abstract : Homo sapiens ACA48 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residue U3797 of 28S rRNA. The pseudouridylation of this residue was previously reported by Ofengand and Bakin (1997).The H/ACA box snoRNAs ACA48 and U67, and the C/D box snoRNA mgU6-77 share the same host gene (EIF4A1).
	GenBank accession number : AJ609447
	Host gene : EIF4A1 (eukaryotic translation initiation factor 4A1).
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA U3797
	sno/scaRNAs with same target 28S rRNA U3797 : HBI-43
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Ofengand, J., and Bakin, A. (1997). Mapping to nucleotide resolution of pseudouridine residues in large subunit ribosomal RNAs from representative eukaryotes, prokaryotes, archaebacteria, mitochondria and chloroplasts. J Mol Biol 266, 246-268.
	Sequence : >ACA48 TGTCCCTGACCTGGGTAGAGTGGCATCTGGTTGGTGATGCCCATCTCATATCAGCCAGGGACAAAGCAACTCCTTGTTCATCCCAGCTTGGCTTTTGATCCGTGCCCATGCCTGGTTCATGCCTTGGACACATAG
	Phylogenic conservation: Alignment - Fasta file
Printer-friendly version