Home

Information

Search

Find guide Rna

Browse

Human-yeast snoRNAs

Links

Contact

Result of your query

U77
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD77 small nucleolar RNA, C/D box 77
	snoid : SR0000032
	Length : 70
	Abstract : Homo sapiens C/D box snoRNA U77. This snoRNA was localized in an intron of the human orthologue of the murine Growth arrest-specific transcript 5 (gas5) gene by Smith and Steitz (1998), and its expression verified by Northern blot. It is predicted to guide the 2'O-ribose methylation of 28S rRNA A1521. U77 and the C/D box snoRNAs U44, U47, U74, U75, U76, U78, U79, U80 and U81 share the same host gene (protein non-coding).
	GenBank accession number : AF141346
	Host gene : GAS5 (mRNA AL110141)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA A1521
	sno/scaRNAs with same target 28S rRNA A1521 : U80
	References : - Smith, C. M., and Steitz, J. A. (1998). Classification of gas5 as a multi-small-nucleolar-RNA (snoRNA) host gene and a member of the 5'-terminal oligopyrimidine gene family reveals common features of snoRNA host genes. Mol Cell Biol 18, 6897-6909.
	Sequence : >U77 AGATACTATGATGGTTGCATAGTTCAGCAGATTTAATCATGAAGAGATGTACTATCTGTCTGATGTATCT
Printer-friendly version