Home

Information

Search

Find guide Rna

Browse

Human-yeast snoRNAs

Links

Contact

Result of your query

U88
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SCARNA6 small Cajal body-specific RNA 6
	snoid : SR0000284
	Length : 266
	Abstract : Homo sapiens U88 scaRNA This RNA was cloned by Darzacq et al. (2002) from HeLa cells. It is composed of an H/ACA box domain and a C/D box domain, and is associated with both fibrillarin and Gar1p. U88 co-localizes with coilin in Cajal bodies, and is predicted to guide the 2'-O-methylation of residue U41 of the U5 snRNA (as U87). The modification of this residue was experimentally established by Krol et al. (1981). The U88 and U87 scaRNAs share the same host gene (FLJ10035).
	GenBank accession number : AY077738
	Host gene : APG16L (hypothetical protein FLJ10035, 309aa).
	Click here to see the position on the UCSC Genome Browser
	Target RNA : U5 snRNA U41
	sno/scaRNAs with same target U5 snRNA U41 : U87
	References : - Darzacq, X., Jady, B. E., Verheggen, C., Kiss, A. M., Bertrand, E., and Kiss, T. (2002). Cajal body-specific small nuclear RNAs: a novel class of 2'-O-methylation and pseudouridylation guide RNAs. Embo J 21, 2746-2756. - Krol, A., Gallinaro, H., Lazar, E., Jacob, M., and Branlant, C. (1981). The nuclear 5S RNAs from chicken, rat and man. U5 RNAs are encoded by multiple genes. Nucleic Acids Res, 9, 769-787.
	Sequence : >U88 GGTCAATGATGAATGGTAAAAGGTCTGAGTCCTCAGATCCCCTCCCGGCATCCCAGTTATCCCCAGCTGCCTCTCCTCCATCGCACTTCAGAAGTGCTGCGATGGGCAGAAGGGCAGCTGACACTCCGTGATGTCCCTCATTCTGTGTTCCTCCGTGAGCTCAGGGAAGACACTGGTTGGCATCCAACAGCTTAGTCACAAAGGGATTTGATTGTTGGGAGTGCTGGTATCTGTGGCTATGATCTGCCTTGTTCAAGCTGAGACCT
	Phylogenic conservation: Alignment - Fasta file
Printer-friendly version