ACA25
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA25 small nucleolar RNA, H/ACA box 25
	snoid : SR0000065
	Length : 134
	Abstract : Homo sapiens ACA25 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residues U801 and U814 of 18S rRNA. The pseudouridylation of these residues was previously reported by Maden and Wakeman (1988). ACA1, ACA8, ACA18, ACA25, ACA32 and ACA40 and the C/D box snoRNAs mgh28S-2409 and mgh28S-2411 share the same host gene (MGC5306).
	GenBank accession number : AJ609461
	Host gene : AK128061 (hypothetical protein FLJ46181, 126aa).
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U801 and 18S rRNA U814
	sno/scaRNAs with same target 18S rRNA U814 : ACA63
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Maden, E. H., and Wakeman, J. A. (1988). Pseudouridine distribution in mammalian 18 S ribosomal RNA. A major cluster in the central region of the molecule. Biochem J 249, 459-464.
	Sequence : >ACA25 GGGTCATTTCAAAGAGGGCTTATGAGGCTGTGAAACCCAGAGCTCTTAACGCTGTGACCAAAGATGGAAGTTCTCTATAGGAAGCCATAGCACTCCTAATGTTTGGTGCTATGTTTTCCTGAGGAGATATAAAA
snoRNABase - http://www-snorna.biotoul.fr/