Home

Information

Search

Find guide Rna

Browse

Human-yeast snoRNAs

Links

Contact

Result of your query

ACA63
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA77 small nucleolar RNA, H/ACA box 77
	snoid : SR0000037
	Length : 125
	Abstract : Homo sapiens ACA63 snoRNA. This H/ACA box RNA was characterized by bioinformatics, and its expression verified by Northern blot and primer extension in mouse (Schattner et al., 2006). ACA63 is a primate-specific Type 3 snoRT. The parental copy, ACA63B, resides in the RANBP1 gene from human to chicken and fishes (Weber, 2006; Luo and Li, 2007).
	GenBank accession number :
	Host gene : ATP2B4 (plasma membrane calcium ATPase 4 isoform 4a)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U814
	sno/scaRNAs with same target 18S rRNA U814 : ACA25
	References : - Schattner, P., Barberan-Soler, S., and Lowe, T. M. (2006). A computational screen for mammalian pseudouridylation guide H/ACA RNAs. Rna 12, 15-25 - Weber MJ. (2006) Mammalian Small Nucleolar RNAs Are Mobile Genetic Elements. PLoS Genet. 2(12):e205 - Luo Y. and Li S. (2007) Genome-wide analyses of retrogenes derived from the human box H/ACA snoRNAs. Nuc. Acids Res. 35(2):559-71.
	Sequence : >ACA63 GCAGACTCACTATGCACCTGACTGTACTTCCAGGCAGGTGCTTTTTCTGTCTGCCAGAGAAACATTCCAGGGTGCTGTGGCTGCCTCACCTATCCAGGGCGATGCAGCTCCCTGGGGACACAGGT
	Phylogenic conservation: Alignment - Fasta file
Printer-friendly version