ACA2b
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA2B small nucleolar RNA, H/ACA box 2B
	snoid : SR0000078
	Length : 137
	Abstract : Homo sapiens ACA2b snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. As its close homologue ACA2a, it is predicted to guide pseudouridylation of U4263 and U4282 in 28S rRNA. The pseudouridylation of these residues was previously reported by Ofengand and Bakin (1997). The snoRNAs ACA2b, ACA2a and ACA34 share with same host gene (FLJ20436).
	GenBank accession number : AJ609427
	Host gene : FLJ20436 (hypothetical protein,152aa )
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA U4263 and 28S rRNA U4282
	sno/scaRNAs with same target 28S rRNA U4263 : ACA2a
	sno/scaRNAs with same target 28S rRNA U4282 : ACA2a   ACA34
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Ofengand, J., and Bakin, A. (1997). Mapping to nucleotide resolution of pseudouridine residues in large subunit ribosomal RNAs from representative eukaryotes, prokaryotes, archaebacteria, mitochondria and chloroplasts. J Mol Biol 266, 246-268.
	Sequence : >ACA2b TTGGCCCTGAATCAAGGCCAGCAGTTTGCTGAAGCTGTTGGTTTCAAGCAGGAGCCTAAAGAATTGTCTTTCTATGGTCTGTTGGCCATTTCATAACTTTGGAAATGTAATGGTCAATTCATTAGAAAGAAACATGA
snoRNABase - http://www-snorna.biotoul.fr/