ACA34
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA34 small nucleolar RNA, H/ACA box 34
	snoid : SR0000076
	Length : 137
	Abstract : Homo sapiens ACA34 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residue U4269 and U4282 of 28S rRNA. The pseudouridylation of these residues was previously reported by Ofengand and Bakin (1997). ACA34, ACA2a and ACA2b share a common host gene (FLJ20436).
	GenBank accession number : AJ609443
	Host gene : FLJ20436 (hypothetical protein,152aa )
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA U4269 and 28S rRNA U4282
	sno/scaRNAs with same target 28S rRNA U4282 : ACA2a   ACA2b
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Ofengand, J., and Bakin, A. (1997). Mapping to nucleotide resolution of pseudouridine residues in large subunit ribosomal RNAs from representative eukaryotes, prokaryotes, archaebacteria, mitochondria and chloroplasts. J Mol Biol 266, 246-268.
	Sequence : >ACA34 GTGGCCCTGACTGAAGACCAGCAGTTGTACTGTGGCTGTTGGTTTCAAGCAGAGGCCTAAAGGACTGTCTTCCTGTGGTCTGTTGGCTGTTCTGGGACCTCAGTAGGGAATGGCTATTTCATTTGGAAGAAACAACC
snoRNABase - http://www-snorna.biotoul.fr/