ACA5
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA5A small nucleolar RNA, H/ACA box 5A
	snoid : SR0000346
	Length : 134
	Abstract : Homo sapiens ACA5 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residues U1625 and U1238 of 18S rRNA. The pseudouridylation of U1625 residue was previously reported by Maden and Wakeman (1988), but these authors could not determine whether U1238 or U1239 was modified. ACA5, ACA5b and ACA5c share the same host gene (TBRG4).
	GenBank accession number : AJ609453
	Host gene : TBRG4 (transforming growth factor beta regulator 4, cell cycle progression 2 protein isoform 2, KIAA0948 protein)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U1238 and 18S rRNA U1625
	sno/scaRNAs with same target 18S rRNA U1238 : ACA5b   ACA5c
	sno/scaRNAs with same target 18S rRNA U1625 : ACA5c
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Maden, E. H., and Wakeman, J. A. (1988). Pseudouridine distribution in mammalian 18 S ribosomal RNA. A major cluster in the central region of the molecule. Biochem J 249, 459-464.
	Sequence : >ACA5 TGCAGCCGTGTCAAATTCAGTACCTGTCCTATGCATGGTAGGCACTGGCCCAGAAGGCTGCCACAGAAACACTGTGACTCATGGGCCCTGTTCCTGTGTCCCAGGCTCAGGGATAAATTTGGTTACAGACATCA
snoRNABase - http://www-snorna.biotoul.fr/