ACA50
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA50 small nucleolar RNA, H/ACA box 50
	snoid : SR0000222
	Length : 136
	Abstract : Homo sapiens ACA50 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residues U34 and U105 of 18S rRNA. The pseudouridylation of these residues was previously reported by Maden and Wakeman (1988). ACA50 and ACA46 share the same host gene (KIAA1007).
	GenBank accession number : AJ609468
	Host gene : CNOT1 (CCR4-NOT transcription complex 1)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U34 and 18S rRNA U105
	sno/scaRNAs with same target 18S rRNA U34 : ACA62
	sno/scaRNAs with same target 18S rRNA U105 : ACA8   ACA36   ACA36B   ACA62
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Maden, E. H., and Wakeman, J. A. (1988). Pseudouridine distribution in mammalian 18 S ribosomal RNA. A major cluster in the central region of the molecule. Biochem J 249, 459-464.
	Sequence : >ACA50 AAGCACTGCCTTTGAACCTGATGTGTCTTGTTTGTAGCTTCACGGGCCAAGCAACAGTGCTAGAGCATAACGACTTGTTATAACTGGGGCTCTTCAGCTCTCAACTGAACTGCTCTTTTAAAAACAAGGTACATTT
snoRNABase - http://www-snorna.biotoul.fr/