ACA5c
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA5C small nucleolar RNA, H/ACA box 5C
	snoid : SR0000347
	Length : 138
	Abstract : Homo sapiens ACA5c snoRNA This H/ACA box RNA was found by Kiss et al. (2004) by the examination of conserved sequences in the introns of the common host gene (TBRG4) of ACA5 and ACA5b RNAs. It was cloned by Gu et al. (2005) from human blood cells and named HBI-80. Its expression was evidenced by Northern blot. A partial sequence of its mouse orthologue was named MBI-80 by Huttenhoffer et al. (2001). As its close paralogue ACA5, this RNA is predicted to guide the pseudouridylation of residues U1625 and U1238 of 18S rRNA. The pseudouridylation of U1625 residue was previously reported by Maden and Wakeman (1988), but these authors could not determine whether U1238 or U1239 was modified.
	GenBank accession number :
	Host gene : TBRG4 (transforming growth factor beta regulator 4, cell cycle progression 2 protein isoform 2, KIAA0948 protein)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U1238 and 18S rRNA U1625
	sno/scaRNAs with same target 18S rRNA U1238 : ACA5   ACA5b
	sno/scaRNAs with same target 18S rRNA U1625 : ACA5
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Huttenhofer, A., Kiefmann, M., Meier-Ewert, S., O'Brien, J., Lehrach, H., Bachellerie, J. P., and Brosius, J. (2001). RNomics: an experimental approach that identifies 201 candidates for novel, small, non-messenger RNAs in mouse. Embo J 20, 2943-2953. - Maden, E. H., and Wakeman, J. A. (1988). Pseudouridine distribution in mammalian 18 S ribosomal RNA. A major cluster in the central region of the molecule. Biochem J 249, 459-464. - Gu, A. D., Zhou, H., Yu, C. H., and Qu, L. H. (2005). A novel experimental approach for systematic identification of box H/ACA snoRNAs from eukaryotes. Nucleic Acids Res 33, e194.
	Sequence : >ACA5c TGCAGTCAAGTCAAATTCAGTGCCCGTTTCTGTCATAGCGGGGGCTGGCCCAGATGGCTGCCACAGCAAGCTCCACAGCTCATGGGCCCTGGGTCACCTACCCTGGGACCTGGGGATAAGTTTGGCTGTGGACAGTG
snoRNABase - http://www-snorna.biotoul.fr/