HBI-43
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD17 small nucleolar RNA, C/D box 17
	snoid : SR0000290
	Length : 237
	Abstract : Homo sapiens C/D box snoRNA HBI-43. This snoRNA was cloned from HeLa cells (A. Kiss and T. Kiss, unpublished) and is the human orthologue of the mouse MBI-43 described by Hüttenhofer et al. (2001). It is predicted to guide the 2'O-ribose methylation of 28S rRNA U3797. The pseudouridylation of U3797 is predicted to be guided by ACA48.
	GenBank accession number :
	Host gene : SNX5 (sorting nexin 5)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA U3797
	sno/scaRNAs with same target 28S rRNA U3797 : ACA48
	References : - Huttenhofer, A., Kiefmann, M., Meier-Ewert, S., O'Brien, J., Lehrach, H., Bachellerie, J. P., and Brosius, J. (2001). RNomics: an experimental approach that identifies 201 candidates for novel, small, non-messenger RNAs in mouse. Embo J 20, 2943-2953.
	Sequence : >HBI-43 GTGAAATGATGATTCAGTTTATCCATTCGCTGAGTGCGCTGCACTGACCTTCTTCCAAGCCTCAGTTCCTGTTCTAGGAACTTGAGGCTATGTAGCCTGAAAATGCCCTGCAGTCTGCAGTGTTCTACTGTGAACTGCTTGTGTGTTGGCAGGCTACCGGTAAGAATGGTTGGTGTCAGCAGGGACGGGGCCCTCTGAGACCCATCTCACAAAGATGAGTGGTGAAAATCTGATCAC
snoRNABase - http://www-snorna.biotoul.fr/