HBII-108
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD19 small nucleolar RNA, C/D box 19
	snoid : SR0000306
	Length : 76
	Abstract : Homo sapiens C/D box snoRNA HBII-108: This snoRNA is the human orthologue of the mouse MBII-108 described by Hüttenhofer et al. (2001). It is predicted to guide the 2'O-ribose methylation of 18S rRNA G683. As the C/D box snoRNA HBII-210, HBII-108 is encoded in an intron of the nucleostemin (NS) gene.
	GenBank accession number :
	Host gene : GNL3 (guanine nucleotide binding protein-like 3).
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA G683
	sno/scaRNAs with same target 18S rRNA G683 : HBII-108B
	References : - Huttenhofer, A., Kiefmann, M., Meier-Ewert, S., O'Brien, J., Lehrach, H., Bachellerie, J. P., and Brosius, J. (2001). RNomics: an experimental approach that identifies 201 candidates for novel, small, non-messenger RNAs in mouse. Embo J 20, 2943-2953.
	Sequence : >HBII-108 ACATGGGTGAGGTACGAGGAAACAGTCTGATAGTCACTGAAGACTGATTAGATCCAACTCTGATCTCAGCAAAGCC
snoRNABase - http://www-snorna.biotoul.fr/