HBII-382
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SCARNA2 small Cajal body-specific RNA 2
	snoid : SR0000023
	Length : 82
	Abstract : Homo sapiens C/D box snoRNA HBII-382. This snoRNA is the human orthologue of the mouse MBII-382 described by Hüttenhofer et al. (2001). HBII-382 is predicted to guide the 2'O-ribose methylation of nts C61 and G11 of the snRNA U2. HBII-382 is a cleavage product of a longer transcript, mgU2-25/61 (see this entry).
	GenBank accession number :
	Host gene : Independent transcriptional unit (Unigene Hs.485112)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : U2 snRNA C61 and U2 snRNA G11
	sno/scaRNAs with same target U2 snRNA C61 : mgU2-25/61
	References : - Darzacq, X., Jady, B. E., Verheggen, C., Kiss, A. M., Bertrand, E., and Kiss, T. (2002). Cajal body-specific small nuclear RNAs: a novel class of 2'-O-methylation and pseudouridylation guide RNAs. Embo J 21, 2746-2756. - Huttenhofer, A., Kiefmann, M., Meier-Ewert, S., O'Brien, J., Lehrach, H., Bachellerie, J. P., and Brosius, J. (2001). RNomics: an experimental approach that identifies 201 candidates for novel, small, non-messenger RNAs in mouse. Embo J 20, 2943-2953.
	Sequence : >HBII-382 GCTCAGAAGTGATGAATTGATCAGATAGACGAGGCCGGGCTTGTCCCCGGCCACTGATTATCGAGGCGATTCTGATCTGGGC
snoRNABase - http://www-snorna.biotoul.fr/