HBII-82
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD111 small nucleolar RNA, C/D box 111
	snoid : SR0000223
	Length : 94
	Abstract : Homo sapiens C/D box snoRNA HBII-82. This snoRNA is the human orthologue of the mouse MBII-82 described by Hüttenhofer et al. (2001). It is predicted to guide the 2'O-ribose methylation of 28S rRNA G3923. In tetraopods and zebrafish, HBII-82 and its paralog HBII-82B are located in the SF3B3 gene (4 copies in zebrafish). In fugu, medaka, stickleback and tetraodon, 2 or 3 copies are localized in the LARP1 (la related protein isoform 1)gene. In ciona intestinalis, three copies of a possible ortholog are located in the RPL10 gene. See HBII-82B file for sequences in Xenopus, fishes and ciona.
	GenBank accession number :
	Host gene : SF3B3 (Splicing factor 3b, subunit 3, 130kD)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA G3923
	sno/scaRNAs with same target 28S rRNA G3923 : HBII-82B
	References : - Huttenhofer, A., Kiefmann, M., Meier-Ewert, S., O'Brien, J., Lehrach, H., Bachellerie, J. P., and Brosius, J. (2001). RNomics: an experimental approach that identifies 201 candidates for novel, small, non-messenger RNAs in mouse. Embo J 20, 2943-2953.
	Sequence : >HBII-82 CAGCCTGAAATGATGACTCTTTAAAAAATTTCATGTCTCTTCTCTGACATTTTTCTCTGGACACAGTTTTTGCCTTATGAATCTGATCAGGCTG
snoRNABase - http://www-snorna.biotoul.fr/