U18B
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD18B small nucleolar RNA, C/D box 18B
	snoid : SR0000212
	Length : 70
	Abstract : Homo sapiens C/D box snoRNA U18B. This snoRNA was originally characterized in an intron of the Xenopus laevis and human RPL1 genes by Prislei et al. (1993). U18B was postulated to guide the 2'O-ribose methylation of 28S rRNA A1313 by Kiss-Laszlo et al. (1996). U18B, two related copies, U18A and U18C, and the C/D box snoRNA U16 share the same host gene (ribosomal protein L4, RPL4 or RPL1).
	GenBank accession number :
	Host gene : RPL4 (ribosomal protein L4)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA A1313
	sno/scaRNAs with same target 28S rRNA A1313 : U18A   U18C
	References : - Kiss-Laszlo, Z., Henry, Y., Bachellerie, J. P., Caizergues-Ferrer, M., and Kiss, T. (1996). Site-specific ribose methylation of preribosomal RNA: a novel function for small nucleolar RNAs. Cell, 85, 1077-1088. - Prislei, S., Michienzi, A., Presutti, C., Fragapane, P., and Bozzoni, I. (1993). Two different snoRNAs are encoded in introns of amphibian and human L1 ribosomal protein genes. Nucleic Acids Res, 21, 5824-5830.
	Sequence : >U18B TCAAAATGATGAGATTCCACTTAATTGGTCCGTGTTTCTGAAACACATGATATTTGTGGAAATTCTGACT
snoRNABase - http://www-snorna.biotoul.fr/