U85
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SCARNA10 small Cajal body-specific RNA 10
	snoid : SR0000073
	Length : 330
	Abstract : Homo sapiens U85 scaRNA. This RNA was cloned by Jády and Kiss (2001) from HeLa cells. It is composed of an H/ACA box domain and a C/D box domain, and is associated with both fibrillarin and Gar1p. It guides both the 2'-O-ribose methylation of the C45 residue of the U5 spliceosomal snRNA, and the pseudouridylation of the neighbouring U46 residue. U85 was subsequently shown to co-localize with coilin in Cajal bodies (Darzacq et al., 2002). Mutagenesis studies showed that U85 contains two copies of the Cajal body-specific localization signal, or CAB box (agAG), common to scaRNAs (Richard et al., 2003). The NMR structure of the U85 5' CAB box was determined by Theimer et al. (2007).
	GenBank accession number : AF308283
	Host gene : CNAP1 (Condensin subunit 1, Chromosome condensation-related SMC-associated protein 1, Chromosome-associated protein D2)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : U5 snRNA U46 and U5 snRNA C45
	sno/scaRNAs with same target U5 snRNA U46 : U89
	References : - Darzacq, X., Jady, B. E., Verheggen, C., Kiss, A. M., Bertrand, E., and Kiss, T. (2002). Cajal body-specific small nuclear RNAs: a novel class of 2'-O-methylation and pseudouridylation guide RNAs. Embo J 21, 2746-2756. - Jady, B. E., and Kiss, T. (2001). A small nucleolar guide RNA functions both in 2'-O-ribose methylation and pseudouridylation of the U5 spliceosomal RNA. Embo J 20, 541-551. - Richard, P., Darzacq, X., Bertrand, E., Jady, B. E., Verheggen, C., and Kiss, T. (2003). A common sequence motif determines the Cajal body-specific localization of box H/ACA scaRNAs. Embo J, 22, 4283-4293. - Theimer, C. A., Jady, B. E., Chim, N., Richard, P., Breece, K. E., Kiss, T., and Feigon, J. (2007). Structural and functional characterization of human telomerase RNA processing and cajal body localization signals. Mol Cell 27, 869-881
	Sequence : >U85 GCCACATGATGATATCAAGGCTGTTGTGATTCAGTTGGTTTGGCTAAGCCCAGGGACCTTTGGCCTGTTAAAGGTCTGTAATCTTGGTGGGCGATACAGAGTTATGTGTGTTCACTGTAAGGGCAGACCAACAAGAACTTTTTCCTACTTTTGAGCTACCTCTTTTTAATAGGGGTGATTCTTCCAGTTGCTGGAGAGAAATTGTGGTAACTGGAGTGAGAGAGTAGGAACAGGGCATGTTCAGGGTATCAGGGCCAAGGGTCCTAAAGGACTTAGCTTGTGTTATGGCCACTGAGAGATGAAACACAGATCTTTGGTAATCTGATGGCT
snoRNABase - http://www-snorna.biotoul.fr/