Home

Information

Search

Find guide Rna

Browse

Human-yeast snoRNAs

Links

Contact

Result of your query

U89
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SCARNA12 small Cajal body-specific RNA 12
	snoid : SR0000075
	Length : 270
	Abstract : Homo sapiens U89 scaRNA This RNA was cloned by Darzacq et al. (2002) from HeLa cells. It is composed of an H/ACA box domain and a C/D box domain, and is associated with both fibrillarin and Gar1p. U89 co-localizes with coilin in Cajal bodies, and is predicted to guide the pseudouridylation of residue U46 in U5 snRNA (as U85). The modification of this residue was experimentally established by Krol et al. (1981).
	GenBank accession number : AY077739
	Host gene : REA (B-cell receptor associated protein, D-prohibitin).
	Click here to see the position on the UCSC Genome Browser
	Target RNA : U5 snRNA U46
	sno/scaRNAs with same target U5 snRNA U46 : U85
	References : - Darzacq, X., Jady, B. E., Verheggen, C., Kiss, A. M., Bertrand, E., and Kiss, T. (2002). Cajal body-specific small nuclear RNAs: a novel class of 2'-O-methylation and pseudouridylation guide RNAs. Embo J 21, 2746-2756. - Krol, A., Gallinaro, H., Lazar, E., Jacob, M., and Branlant, C. (1981). The nuclear 5S RNAs from chicken, rat and man. U5 RNAs are encoded by multiple genes. Nucleic Acids Res, 9, 769-787.
	Sequence : >U89 CAGGCTGATGAGACTAAGGCGAATGCGACTCCGTGCTCTCTGGCCCTTGGCTCCTTGTTGGGGGTGGGGACTACAGATGAGATCTGAAATCTTAGTGGTAGTACCTGAGCCATGACTCCCCACTGTAAGGCCAGATCAATAGCATTGGTGGCCTTGCCTTCATTTCTGGTGCTGCCCCTAGTTCCTGGCAGCAGCCTGCAGGGAGGCCCACAGGTGGGGTCCACGGTAGGGCTGGGCACAAGCCACCTGAGCGCAACCTTGGATCTGACA
	Phylogenic conservation: Alignment - Fasta file
Printer-friendly version