U87
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SCARNA5 small Cajal body-specific RNA 5
	snoid : SR0000283
	Length : 277
	Abstract : Homo sapiens U87 scaRNA This RNA was cloned by Darzacq et al. (2002) from HeLa cells. It is composed of an H/ACA box domain and a C/D box domain, and it is associated with both fibrillarin and Gar1p. U87 co-localizes with coilin in Cajal bodies. It is predicted to guide the 2'-O-methylation of U41 in the U5 snRNA (as U88) and A65 in the U4 snRNA. The modification of these two residues was experimentally established by Krol et al. (1981) and Reddy, Henning and Busch (1981), respectively. The U87 and U88 scaRNAs share the same host gene (FLJ10035). This scaRNA should not be confused with the C/D box snoRNA U87 described by Gogolevskaya et al. (2002), which corresponds to HBII-276. Likewise, the mRNA AY264285, named U87HG (host gene), should be referred to as HBII-276HG.
	GenBank accession number : AY077737
	Host gene : APG16L (hypothetical protein FLJ10035, 309aa).
	Click here to see the position on the UCSC Genome Browser
	Target RNA : U5 snRNA U41 and U4 snRNA A65
	sno/scaRNAs with same target U5 snRNA U41 : U88
	References : - Darzacq, X., Jady, B. E., Verheggen, C., Kiss, A. M., Bertrand, E., and Kiss, T. (2002). Cajal body-specific small nuclear RNAs: a novel class of 2'-O-methylation and pseudouridylation guide RNAs. Embo J 21, 2746-2756. - Reddy, R., Henning, D., and Busch, H. (1981b). The primary nucleotide sequence of U4 RNA. J Biol Chem, 256, 3532-3538. - Krol, A., Gallinaro, H., Lazar, E., Jacob, M., and Branlant, C. (1981). The nuclear 5S RNAs from chicken, rat and man. U5 RNAs are encoded by multiple genes. Nucleic Acids Res, 9, 769-787. - Gogolevskaya, I. K., Makarova, J. A., Gause, L. N., Kulichkova, V. A., Konstantinova, I. M., and Kramerov, D. A. (2002). U87 RNA, a novel C/D box small nucleolar RNA from mammalian cells. Gene, 292, 199-204.
	Sequence : >U87 AGGTCGATGATGATTGGTAAAAGGTCTGATTGCACTGAATGTCACGGTCCCTTTGTTGCCCTCAACTCCCAGCAGCCCATTTTTTCCCTCCCGTCACATTTAAGTCATGTGTATGGGATCATGGAGCAGCTGATAATTTGGGATTCTGTCAGTGTGTGTTTCTGAGAGTGATCGGCTCACAGCTGACGAGTATCCAACAAAACCAGTTACACAGGAGACTGACGAGTGGCAGTCATGGGTGTGATGGTGCATGATCTCAAGTTTTCAATCTGAGACCT
snoRNABase - http://www-snorna.biotoul.fr/