Home

Information

Search

Find guide Rna

Browse

Human-yeast snoRNAs

Links

Contact

Result of your query

ACA42
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA42 small nucleolar RNA, H/ACA box 42
	snoid : SR0000024
	Length : 134
	Abstract : Homo sapiens ACA42 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residues U109 and U572 of 18S rRNA. Maden and Wakeman (1988) could not determine whether U571, U572 or U573, and U109 or U110 were modified. ACA42 and ACA26 share the same host gene. ACA42 presents sequence similarity with, and might be an ancient snoRT of, ACA37B.
	GenBank accession number : AJ609465
	Host gene : KIAA0907 (hypothetical protein, 614aa).
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U572 and 18S rRNA U109
	sno/scaRNAs with same target 18S rRNA U572 : ACA67   ACA67B
	sno/scaRNAs with same target 18S rRNA U109 : ACA67   ACA67B
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Maden, E. H., and Wakeman, J. A. (1988). Pseudouridine distribution in mammalian 18 S ribosomal RNA. A major cluster in the central region of the molecule. Biochem J 249, 459-464.
	Sequence : >ACA42 TGGTAATGGATTTATGGTGGGTCCTTCTCTGTGGGCCTCTCATAGTGTACCCATGCCATAGCAAATGGCAGCCTCGAACCATTGCCCAGTCCCCTTACCTGTGGGCTGTGAGCACTGAAGGGGGTTGCACAGTG
	Phylogenic conservation: Alignment - Fasta file
Printer-friendly version