Home

Information

Search

Find guide Rna

Browse

Human-yeast snoRNAs

Links

Contact

Result of your query

SNORD127
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD127 small nucleolar RNA, C/D box 127
	snoid : SR0000491
	Length : 86
	Abstract : Homo sapiens C/D box snoRNA SNORD127. This C/D box snoRNA was characterized by Yang et al. (2006) using the snoSeeker software. Its expression was experimentally verified by Northern blot. It is predicted to guide the 2’O-ribose methylation of 18S rRNA G1447. Methylation at that position was established by Maden and Salim(1974). This snoRNA is incorrectly named SNORD118 in Yang et al. (2006) and in GenBank file AM413025, and should not be confused with U8 (HGCN approved symbol SNORD118).
	GenBank accession number : AM413025
	Host gene : PRPF39 (PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae))
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA G1447
	References : - Yang,J.H., Zhang,X.C., Huang,Z.P., Zhou,H., Huang,M.B., Zhang,S.,Chen,Y.Q. and Qu,L.H. (2006) snoSeeker: an advanced computational package for screening of guide and orphan snoRNA genes in the human genome. Nuc. Acids Res. 34:5112-5123 - Maden, B. E., and Salim, M. (1974). The methylated nucleotide sequences in HeLa cell ribosomal RNA and its precursors. J Mol Biol 88, 133-152.
	Sequence : >SNORD127 TGGCAACTGTGATGAAAGATTTGGTCTGTATGTAATAGATTTTATTACTAAATGAGGACAACAGTCCCTCTAAACTGATGTTGCCA
	Phylogenic conservation: Alignment - Fasta file
Printer-friendly version