ACA36
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA36A small nucleolar RNA, H/ACA box 36A
	snoid : SR0000374
	Length : 132
	Abstract : Homo sapiens ACA36 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residues U105 and U1244 of 18S rRNA. The pseudouridylation of U105 residue was previously reported by Maden and Wakeman (1988), but these authors could not determine whether U1243 or U1244 was modified. ACA36 and ACA56 share a common host gene (dyskerin). A close paralogue, ACA36B (SNORA36B) resides in the RAB3-GAP150 gene. A primate-specific Type 2 snoRT (SNORA36C) resides in the AAK1 gene.
	GenBank accession number : AJ609463
	Host gene : DKC1 (dyskeratosis congenita 1, dyskerin)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U1244 and 18S rRNA U105
	sno/scaRNAs with same target 18S rRNA U1244 : ACA36B   SNORA36C
	sno/scaRNAs with same target 18S rRNA U105 : ACA8   ACA50   ACA36B   ACA62
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Maden, E. H., and Wakeman, J. A. (1988). Pseudouridine distribution in mammalian 18 S ribosomal RNA. A major cluster in the central region of the molecule. Biochem J 249, 459-464.
	Sequence : >ACA36 TTCCAAAGTGTTGAGTTCAGTCCAGGGCAGCTTCCCTGTTCTGTTAATTAAACTTTGGGACATTAAAATGGGCTAAGGGAGATGATTGGGTAGAAAGTATTATTCTATTCATTTGCCTCCCAGCCTACAAAA
snoRNABase - http://www-snorna.biotoul.fr/