ACA36B
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA36B small nucleolar RNA, H/ACA box 36B
	snoid : SR0000039
	Length : 131
	Abstract : Homo sapiens H/ACA box snoRNA ACA36B. This snoRNA is a paralogue of the snoRNA ACA36 cloned by Kiss et al. (2004).It is predicted to guide the pseudouridylation of 18S rRNA U105 and U1244.
	GenBank accession number :
	Host gene : RAB3-GAP150 (hypothetical protein, 206aa)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U105 and 18S rRNA U1244
	sno/scaRNAs with same target 18S rRNA U105 : ACA8   ACA36   ACA50   ACA62
	sno/scaRNAs with same target 18S rRNA U1244 : ACA36   SNORA36C
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807
	Sequence : >ACA36B TTCCAAAGTGTTAAGTTCAGTTCAGGGTAGCTTCCCTGCTCTGTTAATTAAACTTTGGAACATTGAAACTGGCTAGGGAAAATGATTGGATAGAAACTATTATTCTATTCATTTATCCCCAGCCTACAAAA
snoRNABase - http://www-snorna.biotoul.fr/