ACA62
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA76 small nucleolar RNA, H/ACA box 76
	snoid : SR0000249
	Length : 133
	Abstract : Homo sapiens ACA62 snoRNA. This H/ACA box RNA was characterized by bioinformatics, and its expression verified by Northern blot and primer extension in mouse (Schattner et al., 2006). It maps 181 bp downstream of the U104 C/D box snoRNA gene in a cluster of ESTs. As ACA50, it is predicted to guide the pseudouridylation of 18S rRNA U34 and U105.
	GenBank accession number :
	Host gene : cluster of ESTs
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U34 and 18S rRNA U105
	sno/scaRNAs with same target 18S rRNA U34 : ACA50
	sno/scaRNAs with same target 18S rRNA U105 : ACA8   ACA36   ACA50   ACA36B
	References : - Schattner, P., Barberan-Soler, S., and Lowe, T. M. (2006). A computational screen for mammalian pseudouridylation guide H/ACA RNAs. Rna 12, 15-25
	Sequence : >ACA62 GCGCTGTCTTTGAGCCCCCGCCGAGCTTCCTCGTGGCGCCGGGGGTCAATCTGCAGCGCTAGAGCATGTGCTTGCGCATAACTGGGGCCGCCTGGCCTCCCGCGGGCGGCCTTTTTAACCGCGAGCGACAAGA
snoRNABase - http://www-snorna.biotoul.fr/