U103B
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD103B small nucleolar RNA, C/D box 103B
	snoid : SR0000010
	Length : 91
	Abstract : Homo sapiens C/D box snoRNA U103B. This snoRNA was first cloned from a rat cDNA library, and its human orthologue identified by database search (Vitali et al., 2003). Two perfect copies U103 and U103B, as well as the C/D box snoRNA HBII-251, reside in the same host gene (PUM1). U103 is predicted to guide the 2'O-ribose methylation of G601 of 18S rRNA (same target as HBII-251) . Note that the published sequence of U103 differs from the genomic sequence by 2 nts near its 3' end.
	GenBank accession number : AY349604
	Host gene : PUM1 (pumilio homolog 1 (Drosophila), RNA-binding protein that regulates translation and mRNA stability by binding the 3'UTR of mRNAs).
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA G601
	sno/scaRNAs with same target 18S rRNA G601 : U103   HBII-251
	References : - Vitali, P., Royo, H., Seitz, H., Bachellerie, J. P., Huttenhofer, A., and Cavaille, J. (2003). Identification of 13 novel human modification guide RNAs. Nucleic Acids Res 31, 6543-6551.
	Sequence : >U103B TTGTCTGGCAATGATGACCCACTTGCCCTCACTGAGAACAAAGTTCGGTAATGAGAATCTTTGTTAATGGACTCAAGTTCTGAGCCAGACA
snoRNABase - http://www-snorna.biotoul.fr/