U70
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA70 small nucleolar RNA, H/ACA box 70
	snoid : SR0000373
	Length : 135
	Abstract : Homo sapiens U70 snoRNA. This H/ACA box RNA was cloned from HeLa cells by Ganot et al. (1997b). Its role in guiding pseudouridylation of U1692 in 18S rRNA was evidenced by Ganot et al. (1997b). The pseudouridylation of this residue was confirmed by the same authors. The U70 gene resides in the RPL10 from human to fishes, with an intragenic duplication in zebrafish. Twelve human U70 type 3 snoRTs reside in an intron of a known gene in the sense orientation, including U70B (USP34), U70C (ASTN2), U70D (PHLPPL), U70E (RAB30), U70F (COBLL1) and U70G (RAP1B) (Weber, 2006; Luo and Li, 2007).
	GenBank accession number : Y11164
	Host gene : RPL10 (ribosomal protein L10)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U1692
	sno/scaRNAs with same target 18S rRNA U1692 : U70B   U70C   U70D   U70E   U70F   U70G
	References : - Ganot, P., Bortolin, M. L., and Kiss, T. (1997a). Site-specific pseudouridine formation in preribosomal RNA is guided by small nucleolar RNAs. Cell 89, 799-809. - Ganot, P., Caizergues-Ferrer, M., and Kiss, T. (1997b). The family of box ACA small nucleolar RNAs is defined by an evolutionarily conserved secondary structure and ubiquitous sequence elements essential for RNA accumulation. Genes Dev 11, 941-956. - Weber MJ. (2006) Mammalian Small Nucleolar RNAs Are Mobile Genetic Elements. PLoS Genet. 2(12):e205 - Luo Y. and Li S. (2007) Genome-wide analyses of retrogenes derived from the human box H/ACA snoRNAs. Nuc. Acids Res. 35(2):559-71.
	Sequence : >U70 CCGCAGCCAATTAAGCCGACTGAGTTCCTTTCCTCATGGGGACCCAGTGTGCGATGGCTGCACACAGCAGCTTCCTTGGTAGTGTACGCAGCCTGTTGGTTGTATGGGTTGCTCTAAGGGACCTTGGAGACAGGC
snoRNABase - http://www-snorna.biotoul.fr/