Home

Information

Search

Find guide Rna

Browse

Human-yeast snoRNAs

Links

Contact

Result of your query

U70B
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA70B small nucleolar RNA, H/ACA box 70B
	snoid : SR0000468
	Length : 134
	Abstract : Homo sapiens U70B snoRNA. This H/ACA box snoRNA was described by Weber (2006) as a primate-specific U70 Type 3 snoRT, and was also identified by Yang et al. (2006) and Luo and Li (2007). It is present in human, chimp, rhesus and orangutan, but not marmoset, genomes. In rhesus, a AluMacY3 element is inserted in the snoRNA sequence. The GenBank sequence AM413014 differs from the genomic sequence by 1 bp. Twelve human U70 type 3 snoRTs reside in an intron of a known gene in the sense orientation, including U70B (USP34), U70C (ASTN2), U70D (PHLPPL), U70E (RAB30), U70F (COBLL1) and U70G (RAP1B) (Weber, 2006; Luo and Li, 2007).
	GenBank accession number : AM413014
	Host gene : USP34 (ubiquitin specific protease 34)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U1692
	sno/scaRNAs with same target 18S rRNA U1692 : U70   U70C   U70D   U70E   U70F   U70G
	References : - Luo Y. and Li S. (2007) Genome-wide analyses of retrogenes derived from the human box H/ACA snoRNAs. Nuc. Acids Res. 35(2):559-71. - Weber MJ. (2006) Mammalian Small Nucleolar RNAs Are Mobile Genetic Elements. PLoS Genet. 2(12):e205 - Yang,J.H., Zhang,X.C., Huang,Z.P., Zhou,H., Huang,M.B., Zhang,S.,Chen,Y.Q. and Qu,L.H. (2006) snoSeeker: an advanced computational package for screening of guide and orphan snoRNA genes in the human genome. Nuc. Acids Res. 34:5112-5123
	Sequence : >U70B TGCAGCCAATTAAGCTGACTGAATTCCTTTCCTTATGGGGGTCCAGTGTGCAATGGCTGTAAACAGCAGCTTCCTTGGTAGTGTATGCGGCCTGTTTGTTGTATAGGTTGCTCTAAGGGACCTTGGAGACAGGC
	Phylogenic conservation: Alignment - Fasta file
Printer-friendly version