Home

Information

Search

Find guide Rna

Browse

Human-yeast snoRNAs

Links

Contact

Result of your query

U70C
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA70C small nucleolar RNA, H/ACA box 70C
	snoid : SR0000469
	Length : 136
	Abstract : Homo sapiens U70C snoRNA. This H/ACA box snoRNA was described by Weber (2006) as a human/chimp-specific U70 Type 3 snoRT, and was also identified by Yang et al. (2006) and Luo and Li (2007). It is present in human, chimp, and orangutan, but not rhesus and marmoset, genomes. The GenBank sequence AM413015 differs from the genomic sequence by 1 bp. Twelve human U70 type 3 snoRTs reside in an intron of a known gene in the sense orientation, including U70B (USP34), U70C (ASTN2), U70D (PHLPPL), U70E (RAB30), U70F (COBLL1) and U70G (RAP1B) (Weber, 2006; Luo and Li, 2007).
	GenBank accession number : AM413015
	Host gene : ASTN2 (astrotactin 2)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U1692
	sno/scaRNAs with same target 18S rRNA U1692 : U70   U70B   U70D   U70E   U70F   U70G
	References : - Luo Y. and Li S. (2007) Genome-wide analyses of retrogenes derived from the human box H/ACA snoRNAs. Nuc. Acids Res. 35(2):559-71. - Weber MJ. (2006) Mammalian Small Nucleolar RNAs Are Mobile Genetic Elements. PLoS Genet. 2(12):e205 - Yang,J.H., Zhang,X.C., Huang,Z.P., Zhou,H., Huang,M.B., Zhang,S.,Chen,Y.Q. and Qu,L.H. (2006) snoSeeker: an advanced computational package for screening of guide and orphan snoRNA genes in the human genome. Nuc. Acids Res. 34:5112-5123
	Sequence : >U70C TCTGCAGCCAATTAAGCCAACTGGGTTCCTTTCCTCATGGGGGCCCATTGTGCAATGGCTGCAAACAGCAGCTTTCTTGGTAGTGTATGCAGCCTGTTTGTTGTATGGGTTGCTTTAAGGGACCATGGAAACAGGC
	Phylogenic conservation: Alignment - Fasta file
Printer-friendly version