U70E
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA70E small nucleolar RNA, H/ACA box 70E
	snoid : SR0000471
	Length : 135
	Abstract : Homo sapiens U70E snoRNA. This H/ACA box snoRNA was described by Weber (2006) as a primate-specific U70 Type 3 snoRT, and was also identified by Luo and Li (2007). It is present in human, chimp, orangutan, rhesus and marmoset genomes. Twelve human U70 type 3 snoRTs reside in an intron of a known gene in the sense orientation, including U70B (USP34), U70C (ASTN2), U70D (PHLPPL), U70E (RAB30), U70F (COBLL1) and U70G (RAP1B) (Weber, 2006; Luo and Li, 2007).
	GenBank accession number :
	Host gene : RAB30 (Ras-related protein Rab-30)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U1692
	sno/scaRNAs with same target 18S rRNA U1692 : U70   U70B   U70C   U70D   U70F   U70G
	References : - Luo Y. and Li S. (2007) Genome-wide analyses of retrogenes derived from the human box H/ACA snoRNAs. Nuc. Acids Res. 35(2):559-71. - Weber MJ. (2006) Mammalian Small Nucleolar RNAs Are Mobile Genetic Elements. PLoS Genet. 2(12):e205
	Sequence : >U70E CTGCAACCAATTAAGCCGACCTAGTTCCTTTCCTCTTTGGGGCCTGGTGTTCAATAGCTGCAAACAGCAGCTTCCTTGGTAGTGTATGCAGCCTGTTTCTTGTATGGGTTGCTCTAAAGGACCTTGGAGACAGCC
snoRNABase - http://www-snorna.biotoul.fr/