28S

 18S

 5.8S

 U1

 U2

 U4

 U5

 U6

 U12

Human U2 snRNA

Show All
 AUCGCUUCUCGGCCUUUUGGCUAAGAUCAAGUGUAGUAUCUGUUCUUAUC50
 AGUUUAAUAUCUGAUACGUCCUCUAUCCGAGGACAAUAUAUUAAAUGGAU100
 UUUUGGAGCAGGGAGAUGGAAUAGGAGCUUGCUCCGUCCACUCCACGCAU150
 CGACCUGGUAUUGCAGUACCUCCAGGAACGGUGCACC

modified positions were taken from D÷nmez et al. (2004) RNA 10:4925-1933

Last update: July 01 2016 10:51:10.